Galaxy is designed to work with many different datatypes. Upon file upload, datatype can be detected and assigned (when possible) or user specified (before or after load). Datatype is also assigned by tools when output is created. It is important to note that many tools will only accept as input datasets with the appropriate datatype assigned.

A datatype can be altered in two ways:

1. By the appropriate tool to transform the data from one type to another. See tool groups: Convert Formats, SAM Tools, and NGS: QC and manipulation, or perform a search in the top left Tool Search box.
2. With the Edit Attributes form, reached by clicking on the pencil icon inside of a dataset box in the history.

Tool developers: please see Admin/Datatypes for instructions about adding new datatypes to Galaxy.

Ab1

A binary sequence file in ab1 format with a '.ab1' file extension. You must manually select this datatype when uploading the file.

Axt

blastz pairwise alignment format. Each alignment block in an '.axt' file contains three lines: a summary line and 2 sequence lines. Blocks are separated from one another by blank lines. The summary line contains chromosomal position and size information about the alignment. It consists of 9 required fields.

Bam

A binary file compressed in the BGZF format with a '.bam' file extension.

Bed

Tab delimited format (tabular) with a '.bed' file extension. Sometimes the number of fields is noted in the file extension, for example: '.bed3', '.bed4', '.bed6', '.bed12'. Valid BED files contain columns 1-3, 1-4, 1-5, 1-6 or 1-12.

    Example BED12:
    chr22 1000 5000 cloneA 960 + 1000 5000 0 2 567,488, 0,3512
    chr22 2000 6000 cloneB 900 - 2000 6000 0 2 433,399, 0,3601

Coordinates have a "0-based, fully-closed start" and a "0-based, half-open end" and are reported with respect to the forward (+) strand. This is true for any coordinate field in a BED file, including features aligned to the reverse (-) strand. Simply put: the smallest coordinate is used as the "start" field, and the largest coordinate is used as the "end" field (for a sequence aligned to the reverse (-) strand, the "end" would be the beginning of the alignment and the "start" would be the end). This can be confusing when first used. Fortunately, an excellent discussion of the BED coordinate system (also used in Interval and certain other data formats) is at UCSC's genomewiki: http://genomewiki.ucsc.edu/index.php/Coordinate_Transforms

For example, the first 100 bases of a chromosome would be given the coordinates: chromStart=0 and chromEnd=100.

• In a display application, a feature with these coordinates would overlap chromosome bases 1-100. This overlap could be on either the (+) or (-) strand, depending on the strand assignment in column 6.
• In a computational algorithm, a feature with these coordinates would represent a chromosome base range with the mathematical notation of [0,100), representing the 0-based numbered chromosome positions 0-99.

Also, see Interval format for more discussion about ""0-based, half-open start, fully closed end" coordinate system.

BED format does not require a header or custom track and/or browser line, but may have one, starting with a "#" or "track" or "browser" or all three. If extracted from UCSC's Table browser or Downloads area, a BED file may start with a 'bin' column. This is an index number and the column should be removed as a first step prior to any analysis (use tool Text Manipulation: Cut columns). This Cut tool can also be used to rearrange the columns of an Interval file to create a BED file.

3 required fields:

• 1. chrom - The name of the chromosome (e.g. chr3, chrY, chr2_random) or contig (e.g. ctgY1).
• 2. chromStart - The starting chromosome position of the feature. The start is 0-based, fully-closed. For example, the first base in a chromosome is numbered 0.
• 3. chromEnd - The ending chromosome position of the feature. The end is 0-based, half-open.

9 optional fields:

• 4. name - Defines the name of the BED line. A null or undefined name can be assigned as "." (a single dot, no quotes).
• 5. score - A score between 0 and 1000. A null or undefined score can be assigned as "0".
• 6. strand - Defines the strand - either '+' or '-'. A null or undefined strand can be assigned as "." (a single dot, no quotes). If strand is set to a "." or is absent, "+" strand is assumed.
• 7. thickStart - The starting position for the coding region (start codon) or other internal feature.
• 8. thickEnd - The ending position for the coding region (stop codon) or other internal feature.
• 9. itemRgb - An RGB value of the form R,G,B (e.g. 255,0,0). Is used for display in certain browsers. A null or undefined itemRgb value can be assigned as "0".
• 10. blockCount - The number of blocks (exons) in the BED line.
• 11. blockSizes - A comma-separated list of the block sizes. The number of items in this list should correspond to blockCount.
• 12. blockStarts - A comma-separated list of block starts. All of the blockStart positions should be calculated relative to chromStart. The number of items in this list should correspond to blockCount.

The core field definitions above are based on the UCSC Genome Browser BED specification: http://genome.ucsc.edu/FAQ/FAQformat.html#format1

Fasta

A sequence in FASTA format consists of a single description line and one or more lines of sequence data wrapped to a consistent length. The first character of the description line is a greater-than (">") symbol.

>sequence1
atgcgtttgcgtgcatgcgtttgcgtgcatgcgtttgcgtgcatgcgtttgcgtgc
gtcggtttcgttgcatgcgtttgcgtgcatgcgtttgcgtgcatgcgtttgcgtgc
atgcgtttgcgtgc
>sequence2
tttcgtgcgtatagtttcgtgcgtatagtttcgtgcgtatagtttcgtgcgtatag
tttcgtgcgtatagtttcgtgcgtatagtttcgtgcgtatagtttcgtgcgtatag
tggcgcggt

Galaxy FASTA format rules:

• the identifier name for a sequence is the first "word" after the ">" symbol in the description line
• no spaces are between the ">" symbol and the identifier name
• any content in the description line after the first white space (space, tab, etc.) is ignored by most tools
• identifier names must be unique for each sequence contained within any single FASTA dataset
• all sequence lines are wrapped to the same length (40-80 characters is recommended)

Best practices:

• confirm the format of a FASTA dataset at the start of an analysis project
• if a FASTA dataset is used as a Custom Reference Genome, use the same dataset for all steps

Troubleshooting:

• Some tools will compensate for inconsistent sequence line wrapping, but others will not. If a fasta dataset has inconsistent wrapping or is not wrapped, use the tool FASTA manipulation -> FASTA Width formatter to reformat.
• Including blank lines in a FASTA dataset will cause errors with many tools. Use the tool Filter and Sort -> Select lines that match an expression with the options "that: NOT Matching" and "the pattern: ^$" to remove.
• Certain sources produce FASTA datasets with non-unique identifier names. Use the tool NGS: QC and manipulation -> Rename sequences to assign unique identifier names.

For more details, please see the Wikipedia FASTA_format entry.

Fastq

While the basic FASTQ format remains somewhat constant, identifiers can change quickly when new technologies are introduced. One of the best resource for understanding current formats is the Wikipedia FASTQ_format entry.

When using Galaxy, many tools require that input FASTQ files be standardized as the first step in an analysis. Use the tool NGS: QC and manipulation -> FASTQ Groomer. Instructions on the tool form explain how to use and the resuling output format.

FastqSolexa

FastqSolexa is the Illumina (Solexa) variant of the Fastq format, which stores sequences and quality scores in a single file:

@seq1
GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT
+seq1
hhhhhhhhhhhhhhhhhhhhhhhhhhPW@hhhhhh
@seq2
GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG
+seq2
hhhhhhhhhhhhhhYhhahhhhWhAhFhSIJGChO

Or:

@seq1
GAATTGATCAGGACATAGGACAACTGTAGGCACCAT
+seq1
40 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4
@seq2
GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG
+seq2
40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9

GFF

GFF lines have nine required fields that must be tab-separated.

• Fields are:
• seqname
• source
• feature
• start (1-based)
• end
• score
• strand
• frame
• group

GFF format is also known as [[http://en.wikipedia.org/wiki/General_feature_format|General Feature Format 1 or GFF1. The official specification is at http://www.sanger.ac.uk/resources/software/gff/spec.html (notes in the GFF2 specification describe GFF1).

The UCSC Genome Browser GFF specification:http://genome.ucsc.edu/FAQ/FAQformat.html#format3

GTF

GTF lines have nine required fields that must be tab-separated. (Similar to GFF format)

• Fields are:
• seqname
• source
• feature
• start (1-based)
• end
• score
• strand
• frame
• attribute

GTF format is also known as [[http://en.wikipedia.org/wiki/General_feature_format|General Feature Format 2 or GFF2. The official specification is at http://www.sanger.ac.uk/resources/software/gff/spec.html (GFF2 specification).

The UCSC Genome Browser GTF specification:http://genome.ucsc.edu/FAQ/FAQformat.html#format4

GFF3

Similar to GFF and GTF in having nine tab-seperated columns of data at the core of file and having a 1-based start coordinate. However, GFF3 format has data that is grouped differently between lines (and sets of lines), can be hierarchically ordered, and can contain extra content such as FASTA sequence. Seeing the official specification (and online validation tool) for details is highly recommended.

Known as [[http://en.wikipedia.org/wiki/General_feature_format|General Feature Format 3, or GFF3.

The official specification is at http://www.sequenceontology.org/gff3.shtml.

Interval

Interval format, also known as "Genomic Intervals" is a datatype developed by the Galaxy team. This format incorporates a 0-based genome coordinates and labels in a tab-delimited file with no requirements on column order. (See BED format for a discussion of the ""0-based, half-open start, fully closed end" coordinate system ). Or, this quick reference:

0-relative positions, half-open start, closed stop: Interval, BED, others [0,100) == 0-100 in files == 0-99 in calculations == 1-100 in display

1-relative positions, closed start and closed stop: MAF, others [1,100] == 1-100 in files == 1-100 in calculations == 1-100 in display

Interval dataset start with definition line that assigns the column attributes. Columns are individually assigned to an Interval attribute CHROM, START, STOP, NAME, STRAND, SCORE, COMMON. The columns may be in any order and only CHROM, START, and END are required. To add/assign additional columns, use the "Edit Attributes" form (click on pencil icon in top right corner of dataset).

Most common bioinformatics coordinate data formats can be interpreted as or transformed to Interval format. For example: '.bed'}} datasets (always), 0-based coordinate '.tab' or '.txt' datasets, 1-based '.GFF/.GTF/.GFF3' datasets (use Convert Formats -> GFF-to-BED), and others.

Example definition line:
#CHROM START END STRAND NAME SCORE COMMENT

• 1. CHROM - The name of the chromosome (e.g. chr3, chrY, chr2_random) or contig (e.g. ctgY1).
• 2. START - The starting chromosome position of the feature. The first base in a chromosome is numbered 0. See BED format (above).
• 3. END - The ending chromosome position of the feature. For example, the first 100 bases of a chromosome are defined as chromStart=0, chromEnd=100.
• 4. STRAND - Defines the strand - either '+' or '-'. Optional value, null or undefined is omitted or a "." ("dot" without quotes).
• 5. NAME - Name for the feature. Free text, no whitespace. Optional value.
• 6. SCORE - Numeric value for the feature used for calculations and display. Optional value.
• 7. COMMENT - Free text, no whitespace. Optional value.

Example:

#CHROM START END   STRAND NAME COMMENT
chr1   10    100   +      exon myExon
chrX   1000  10050 -      gene myGene

Lav

Lav is the primary output format for BLASTZ. The first line of a '.lav' file begins with '#:lav.'.

MAF

TBA and multiz multiple alignment format. The first line of a .maf file begins with ##maf. This word is followed by white-space-separated "variable=value" pairs. There should be no white space surrounding the "=".

Scf

A binary sequence file in 'scf' format with a '.scf' file extension. You must manually select this 'File Format' when uploading the file.

Sff

A binary file in 'Standard Flowgram Format' with a '.sff' file extension.

Tabular (tab delimited)

Any data in tab delimited format (tabular). May end with the extension '.tab' or '.txt'.

Wig

The wiggle format is line-oriented and ends with the extension '.wig'. Wiggle data is preceded by a track definition line, which adds a number of options for controlling the default display of this track. (more)

Plain text

Any plain text file, commonly ending with the file extension ".txt".